Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_444H8-3
Clone ID CMHD-GT_444H8-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_444H8-3
Sequence
ACGTCAACGAGTGTGATGAGGCAGAGGCAACCTCCCCACTCTGCATCAATGCGCGCTGTGTCAACACTGACGGCTCCTTC
CGCTGTATCTGTCGTCCAGGATTTGCTCCCACGCATCAGCCACATCACTGTGCGCCTGCTCGACCCCGGGCCTGAGCAGG
GGTGCCAAATCTCCCACTATACCTGAGCACCGGGAGCTTCCAGAGCACGCCTGCCTCCCTCCCTCTAGTCTGCATGTGTG
CAAGGATGTCAGACAGTCTCGACTTAGGATGGACAGACACAGAGGGGTGCCTTCTATGGTGCCAGCCTGTCATGCCCAGT
CCCTCCCATCAGTGCCCTGGGCCTGTCCTGGGTCCCCTGACACATTACTTGCCCTTTTATACAATTTTCAATTAAAACAC
CTATTTTGT
Sequence Type mRNA
Unitrap ID UNI21265

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28090161..28090569 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es