Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_448A8-3
Clone ID CMHD-GT_448A8-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_448A8-3
Sequence
GATTCAGTGAAGAAGGAAGCCTGTATGTTCTGAAGGGTGACCGCACGATTGAGTTTGACGGGGAGTTCGCAGCAGATGTC
TTAGTGGAATTTCTCTTGGATCTCATTGAAGACCCAGTGGAGATCGTGAATAACAAGCTGGAGGTCCAGGCCTTTGAGCG
CATCGAGGACCAGACCAAGCTCCTTGGCTTCTTCAAGAATGAGGACTCAGAATATTACAAAACATTCCAAGAGGCTCCTG
AACACTTCCAGCCTTACATCAAGTTCTTTGCCACCTTTGACAAGGCGGTGGCAAAAAAGTTATCCTTGAAGATGAACGAA
GTTGGCTTTTATGAGCCATTTATGGATGAGCCCAATGTCATCCCTAACAAACCTTACACAGAAGAGGAGCTTGTGGAGTT
TGTGAAGGAACATCAAAGACCCACCCTACGTCGCTTGCGCCCAGAGGACATGTTTGAAACATGGGAAGACGACTTGAATG
GGATCCACATCGTGGCCTTTGCGGAGAAGAGTGACCCAGATGGCTATGAGTTCCTAGAGATCCTGAAACAGGTTGCCCGG
GACAACACTGACAATCCTGACTTGAGCATCTTGTGGATTGACCCAGATGACTTTCCACTGCTTGTTGCTTACTGGGAGAA
GACTTTCAAGATTGACCTGTTCAAGCCACAGATTGGGGTGGTGAATGTAACCGATGCTGACAGTATCTGGATGGAGATCC
CAGATGATGACGACCTGCCCACAGCCGAGGAGTTGGAAGACTGGATTGAAGATGTGCTTTCTGGAAAGATCAACACTGAA
GATGATGAC
Sequence Type mRNA
Unitrap ID UNI37353

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101916988..101949233 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027861 (Casq2) NP_033944 calsequestrin 2 Gene [Source:MGI Symbol;Acc:MGI:1309469]

 
Come back to gene ENSMUSG00000027861


For any suggestions or comments, please send an email to unitrap@crg.es