Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST20763-NR
Clone ID PST20763-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST20763-NR
Sequence
TTGGGCACTCTGCCCAAATGGCATTTCCTCCTTAAAGAGACTGCTCTTTTAGAGGCAGACAGATAGACACACAAACACAC
TACAGAGTGTCTAAGTCACCTTCCATTCTCTGGAGCAGACCCCGTTCCCTGGTCATGGTGGGGATGGGGTCGGAGTGCAG
ATTAGATGCTTGTTTTTAGCACCCAGGGTCCAAAGCTGGGGTTGGGGGTTGAAGCCCTCTGTTTGCCTCTGGGTGCTNCN
N
Sequence Type genomic DNA
Unitrap ID UNI37355

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97686421..97686652 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es