Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST19241-NR
Clone ID PST19241-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST19241-NR
Sequence
GTCTGAACATAGCTACACTGTACTCATATAAATAAAACAAATCTTTAATTTTTTTTTTAAAATAAGTCTAATGTGTGCAG
TAACCTCTGGCAGCATTTGGTTAGGAATTTTCTGGAGGTAGGTCACGGTGAGCGCAACACAACACATCTACACACTCTAC
GCTAAATTTTCCGGGGGCCAAAATTGAATTGAAAAACGCAAATACGGGAAAAGAACCTCCAAAGCAACAGGGAAGGACCT
GCCTAACACCTCAGAATGCACGCCAGAACGGGAAAGGGACAAAGGTTGATCCCCTGAGGTTACCCTGCCTCCTAACAAAT
GGNACTTTGCGTGGTCAACCACCTCTCCATATTGGAAGCACTTTTATTTGGAAAATATTTTTATTTTTTTTTTAAATAAA
TTTTTAACCTTTTCTTATTTGCTATATTTGGGGTGTTTTTTGGCCCTGCCATTGCCCCGGACCGGCGAAGGGATCTCCGT
TCGTGACCCAATGGCCGTATTGCCTGCCTCCCCCACCTCTCCCTACCCCCCCCCCCCCCCCCCNNNNN
Sequence Type genomic DNA
Unitrap ID UNI23415

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28981587..28981716 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043535 (Setx) NP_932150 senataxin Gene [Source:MGI (curated);Acc:Setx-001]

 
Come back to gene ENSMUSG00000043535


For any suggestions or comments, please send an email to unitrap@crg.es