Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST26452-NR
Clone ID PST26452-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST26452-NR
Sequence
GGGGGACGAAATGCATCCCAGCCTGTAAAAAAGCAGCCTGTTGCCACACTGCTCCTTTTTCAGGTTGGAAGCAATACGAT
GGGCAGATCGTCCTGTATTCCTTCCTTGCCCTCCCGACCAGCCTGGGCCAGTTTCATTAGTGTTCATTTGCTGGGCACGG
CTGGGGCAGGGTCCAGTAAGTTCACAGTCTGCATGGATAATGTTGCTCAAACACAACATGCCCCGACG
Sequence Type genomic DNA
Unitrap ID UNI6848

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8972994..8973213 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071650 (Ganab) NM_008060 alpha glucosidase 2 alpha neutral subunit Gene [Source:MGI Symbol;Acc:MGI:1097667]

 
Come back to gene ENSMUSG00000071650


For any suggestions or comments, please send an email to unitrap@crg.es