Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST26097-NR
Clone ID PST26097-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST26097-NR
Sequence
TTAGCTTTCAGGGATGTTAATGACTCTGAGCACAGTCCTATTTTTATTCTTTCTTCTTGCCTTAAAGGACGAACCGCACC
TTGCCTAGGTTGGTTGTTCACTCCTGTAACCCTTTGATGCCTTTGGACAAGGAAACTAGAGAGGATCAGAAATTGCAGGT
CTTTCTCTGAGCCCCAAGGACAGCCCTGAGGTTCGGACTGCCTAAAACCCAACTCAGTCCAGCCCTTTAGCTCTGTGTTC
ACGGGACAACCCTTACCTTCTTGCCTCCTAACTTTACAGGATGTTTTAGTCTATTTTCTATAATACATGCC
Sequence Type genomic DNA
Unitrap ID UNI4851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40506459..40506761 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042032 (Mat2b) NM_134017 methionine adenosyltransferase II, beta Gene [Source:MGI (curated);Acc:Mat2b-001]

 
Come back to gene ENSMUSG00000042032


For any suggestions or comments, please send an email to unitrap@crg.es