Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST26087-NR
Clone ID PST26087-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST26087-NR
Sequence
CTATCTAGGAAATTCTAGGTTTGTGATGGAGAAATACACAGCTCTTTTTTTCTAAGACAAAACATCTGCTAGTTTATTTT
TACAATTTTGTTACATTAAGCCTGAGGAAAAGCAAGCTAAAAGGATTTTTATTCCTTTTAGTAGCAACCAAACTTTGATA
GTAATGACTTTTTTTTAATATACTGTATTTTTTTAAGAACAAAGTTAAAACTTAAAAAGAGGCTGAGGATGGAAGGAACT
TCTTTGTTCTATCTTCTTCAGAATGTTAGAAGTCTTAAGAACTCAGGACAAGCAGCAGACTTACATGCC
Sequence Type genomic DNA
Unitrap ID UNI1575

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108420837..108421144 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006673 (Qrich1) NP_001107591 glutamine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1916482]

 
Come back to gene ENSMUSG00000006673


For any suggestions or comments, please send an email to unitrap@crg.es