Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST25999-NR
Clone ID PST25999-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST25999-NR
Sequence
TTTGTGCCACCTGCATCTGTGGCACATTAGTCCCATGGTAGAGAAGTTGACAGCTATGATTCATTGTGATTTAAAAAAAA
TTTTTTAAACACCTAGAAAATACTATATTGTAAAACCTGATATATTATTTTCCCGGGAATGGGGGAGGAGGGAATGACCT
TACAGGTTTTAGTTCAACTTCAAATGCATTGAGACCTTACAGTTAAATGCTAATGGCTTGATGTGAAGTGCTCACTATGC
TATAGTTAATTTTGGTTGCCATAGATTTAAGGAATCAGCGTGTTTTACGTACTTCGTATAGATTGCATGC
Sequence Type genomic DNA
Unitrap ID UNI350

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62326973..62327282 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075009 (Tet1) tet oncogene 1 Gene [Source:MGI Symbol;Acc:MGI:1098693]

 
Come back to gene ENSMUSG00000075009


For any suggestions or comments, please send an email to unitrap@crg.es