Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST25650-NR
Clone ID PST25650-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST25650-NR
Sequence
AAATAAATACAAGCTTGTTTTAAATACTGGAGTCTCGTGAATTTGGAGCCTTATTTAAACCTACTTAACCATGCATGATG
TTCATGTAGCAAAATGTTACCAGGTTTGGACTTTTTTCTTTGTTGTTTAATAGATACTTTTGTATTTTAAATGTGAACAA
GAAATCCTCTTGGAATTCCAAAATAGAAATTTGCAGAAGTTAATTTGCTACCATATAGTGCTAATGGCTAGTCAGCCAAA
CATGGCCGAATAGTGTAACATTTTGTGAGTTAGCCTGCTTAAGTAGTAAAATACTGTTTGGTGAGGCAGATTTTACGACC
TGGCAAAATAAATGGTGAGGGAAAAGTATTTATAGACCTTACCCTTTACTAGGAAAGAATTGAATCTGTTTTTAAAATAG
TGAAAAATGGACTTTATCTAATTTGTTNCTATAGACAATGTAACTTTAAAAAATAACCCTTAATTCCCCA
Sequence Type genomic DNA
Unitrap ID UNI7823

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13111215..13111610 366
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068039 (Tcp1) NM_013686 t-complex protein 1 Gene [Source:MGI Symbol;Acc:MGI:98535]

 
Come back to gene ENSMUSG00000068039


For any suggestions or comments, please send an email to unitrap@crg.es