Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST25445-NR
Clone ID PST25445-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST25445-NR
Sequence
GTGGCAGCCTCTCACACCTTCCAATGTTTAATCAGTTGCAACATGGGGCCAGACCGACGCCTCCTCCGTGGGCACCATAG
ACATGCC
Sequence Type genomic DNA
Unitrap ID UNI32335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37107464..37107549 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  

 
Come back to gene ENSMUSG00000083534


For any suggestions or comments, please send an email to unitrap@crg.es