Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST24803-NR
Clone ID PST24803-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST24803-NR
Sequence
CAGATAACATTTAACTTAGGTCAGAAGGGCGGGAGATAGGGAGGCGCCGGGCCAGTCCGGACATGCC
Sequence Type genomic DNA
Unitrap ID UNI34146 UNI34980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8960423..8960487 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048424 (AC139209.10) RNB3L_MOUSE Isoform 2 of Q6PDH4 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6PDH4-2]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 34193674..34193738 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122108071..122108135 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031831 (Lrrc50) NM_026648 leucine rich repeat containing 50 Gene [Source:MGI (curated);Acc:Lrrc50-001]

 
Come back to gene ENSMUSG00000031831


For any suggestions or comments, please send an email to unitrap@crg.es