Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST24667-NR
Clone ID PST24667-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST24667-NR
Sequence
TTCCTGGCTGCCTTGGAGCTCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAATCCGCCTGCCTCTGCCTCCCGAGTGC
TGGGATAAAAGCCTTTCCCCACCACGCTTAACACGGATTTTCTTACCAATTAGCCACTGATGTGTGGCTTAGGTTCTTAA
GAAAAAAATCTAGGTTGACATTTTCAGAAAGAAAAGATAATGAGGTGCTTTAACACCACCAACACACACACACAAACACA
CCTGTCTCTCTAGCTCTGGCTGTCCTTGGAGACCTCTGCAGACCAGGCTGGCCTCAAACCTCCAGTATTCACCTGCTTCT
CTCTCTGTCTTCCCTAGCCCTGTGGTTAAAGATGTGCTCCAACGACGCACTCGCCTTCCATCATCTTGATGCTAAAAAAG
ATTGTGTTGTTTACTGTGTGTGATTTCCAGTTTGGAGGTTTAAGCAACCCACATTGTATGCAACTCTTTGAACACCTCCC
CAACCCTTTCTGCCCTCCATAAATGAACCCAGGATTCTCTGGCTGGTTAGGCCACCTAACCCACATTGAATCCTATGAAC
TGCTTTCGTGATCTGGGGCTGCCCACGCGAGATTCTCTGACCTGGCATCCGCTGCAATTATAA
Sequence Type genomic DNA
Unitrap ID UNI1642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108162232..108162595 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005698 (Ctcf) NM_007794 CCCTC-binding factor Gene [Source:MGI (curated);Acc:Ctcf-001]

 
Come back to gene ENSMUSG00000005698


For any suggestions or comments, please send an email to unitrap@crg.es