Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST24506-NR
Clone ID PST24506-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST24506-NR
Sequence
TTCCACAGCTGGCTAGAGATCTGTTACACCCTTCCTTGGAGGAGGAGAAGAAAAAACATAAGAAGAAACGGCTGGTTCAG
AGCCCAAATTCTTACTTCATGGATGTGAAATGTCCAGGTATAAAATTTCAAATTTCCCTGTCCTAAAGGACGTTTCAGGA
AAGATTCACACTTTAATAAGTCAGGATCCACTGTTGACTAAAAATGACATTACAGAATTGTCATAAGGGTCATTTTAAAG
AAACATACTCAAACCTTTGTAAAAACATATGGGAGCCAGGTAAAGGATACGTTGACTTAAGTCTTTAACCTTAAGATGAT
CATTAAGATGATGAATTTTCTTTTTTGCAATGCAAATAAAATATATGTTGGATTCTTCATTCCTCAAACTGCTGTCTGAT
GTGTTTGCTATACCCCATATGTGTCTGTTTAGTACTTAAACATGCC
Sequence Type genomic DNA
Unitrap ID UNI14988

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66794630..66795067 416
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036781 (Rps27l) NM_026467 ribosomal protein S27-like Gene [Source:MGI Symbol;Acc:MGI:1915191]

 
Come back to gene ENSMUSG00000036781


For any suggestions or comments, please send an email to unitrap@crg.es