Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST25114-NR
Clone ID PST25114-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST25114-NR
Sequence
GTAAGCATATGTCTGGGTCTAGATTCATTTGTTCACTGTTTACCTATTTATCTGTTTCTCTTGCCTGGTCCTTGGTCCTT
ACACTTTCTAGTCTGTAATGTTCTTTTCTCCATCATTTCCATGACTATCCCTTCTTCTCTCTGTGTAGCCTAGGCTGTCC
TCAGATTTGCACTACTCCTACCCCAGTTTCCCAAGCACTGGGGTTACTGTGGGAGCATGC
Sequence Type genomic DNA
Unitrap ID UNI1141

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48529351..48529570 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023994 (Nfya) NM_010913 nuclear transcription factor-Y alpha Gene [Source:MGI Symbol;Acc:MGI:97316]

 
Come back to gene ENSMUSG00000023994


For any suggestions or comments, please send an email to unitrap@crg.es