Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST24944-NR
Clone ID PST24944-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST24944-NR
Sequence
ATTTCTTGTTAGACTATGTCTGCAAGTAAATTCTAAAAACAACTAAGGTAATTCTCAAATTAATTACCTACAAAATAATT
ACCTGGAATAATATTCTGAATGGGAACTTTCCTAAAATGTAGATGTGACCAAGCCAAATGTTTTCAGGGGTGATAGTGCA
CAAATGGAAATTAGCTTTCTGGCATTGTACAGAGTGCTAAAATTCCAAGAGTGTATGACTTGCCTTTAATCCCAGTACTT
GAGAGACAGAAGTGGGCAGATCTCTGAGTTTTGAGACCCCTGTCCCTTTAAAGGGGTGGTGGTTAAGGGCAATAGTGGCA
TACACCTTTAGTCCCAGCACTTAGGAGGCCAGTGGCAAGCGGATCTCTTTTGAAGTTTGAAGACAGCCAGGGCCCACCAC
AGAGAAACCCCCTGTCTGGAAAAAAAAATTGGGGGATGGGGAGTGAGATCTGCTGCTGAAGGTGGGCCTTAACGTTTAGG
GCAT
Sequence Type genomic DNA
Unitrap ID UNI7489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12744683..12745100 384
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]

 
Come back to gene ENSMUSG00000031010


For any suggestions or comments, please send an email to unitrap@crg.es