Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST24935-NR
Clone ID PST24935-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST24935-NR
Sequence
CTCCTAGGATTTATTCCGGGAACGTTGTAATCGAGGCCTGATCAGCGTCAGAACGGCCCTGCCTAGAGCGATCTTTGTGG
CCACGCTGGAGAGCGGACTGCGGAGACTGTTGTTCCCTCGTTTCTGGGCACTAATAAAGGTGACTCCCTAGTGCTGGGGT
TCTCAGGGACATGCC
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180444284..180444457 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es