Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST23553-NL
Clone ID PST23553-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST23553-NL
Sequence
GCATGCCTTTAATTCCAGCATTCGGGAGGCAGAGGCAGGTAGATTTCTCAGTTTGTGGCCAGCCTGGTCTACAGAGTGAG
TTCCAGGACAGCCAGGGCTATACA
Sequence Type genomic DNA
Unitrap ID UNI17341

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29110237..29110340 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003435 (Supt5h) NM_013676 suppressor of Ty 5 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1202400]

 
Come back to gene ENSMUSG00000003435


For any suggestions or comments, please send an email to unitrap@crg.es