Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST22509-NL
Clone ID PST22509-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST22509-NL
Sequence
CCAGAGAGATGAAAAGAAAGGGAGAAGAGACTCCACAGAGCTTTCCCCTGCCCTCCATGTATGTCCTGGCAGCTTAGCAC
AGGAATAACTAAACAACAAAAACTTGCAAAACCTATTTTACACAGCCCCATGTATTTAAGCTATAATTTTATATTTAACT
TTTAACAGGGAATTTATCCTTGCATTTTTGCAAACCATTGTTTAGAGAAATGAAGTATGGTTGTTGTTAATACAAGAATC
TGCAATAGAAAGTAACTGTTTCTTCCTTCTCCTTCCCCACTTTTGATTTCACAGAAACTGAAAGCCATAGAGCAGCTAAA
AGAGCAGGCAGCCGCCGGGAAACAGCTAGAAAAAAATCAGGTAAGCCCTCGCTTTCCCTTTGGTT
Sequence Type genomic DNA
Unitrap ID UNI14016

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58360204..58360585 371
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027810 (Eif2a) NM_001005509 eukaryotic translation initiation factor 2, subunit 1 alpha Gene [Source:MGI (curated);Acc:Eif2a-001]

 
Come back to gene ENSMUSG00000027810


For any suggestions or comments, please send an email to unitrap@crg.es