Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST22218-NL
Clone ID PST22218-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST22218-NL
Sequence
TCCCCTACAGTTTTCGTCCCAGCCCACGGAACAAGCCGCAAGAGGAAAGGCTATTGGTGGAGAGCGCAGCCAATGGGCGA
GCCTGTTACTAGCCTGCGCCGTGTGCGGCGTAGGAGCGGCGCTTGAGGCCTGGAAGCGTTCCGCGGCCTGCCGGGTCAGC
ACCATGAGCTCCATCGGCACTGGGGTGAGTCTCTCCGCGCCGTCTCTTCCAGTTCGGGGTTGAAGGCAGTGAGGAAGCCC
GGCTGCGGCTCGGAGGGCCGCTGGATCCCCG
Sequence Type genomic DNA
Unitrap ID UNI443

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 72075572..72075841 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060073 (Psma3) NM_011184 proteasome (prosome, macropain) subunit, alpha type 3 Gene [Source:MGI Symbol;Acc:MGI:104883]

 
Come back to gene ENSMUSG00000060073


For any suggestions or comments, please send an email to unitrap@crg.es