Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST22185-NL
Clone ID PST22185-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST22185-NL
Sequence
GCATGCTATTCTAGAAGCTGCTGCTGCTGCTGGGTATTTAGTATATACTTAATAAACATAACAC
Sequence Type genomic DNA
Unitrap ID UNI37393

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 131077424..131077486 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031264 (Btk) NM_013482 Bruton agammaglobulinemia tyrosine kinase Gene [Source:MGI (curated);Acc:Btk-002]

 
Come back to gene ENSMUSG00000031264


For any suggestions or comments, please send an email to unitrap@crg.es