Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST21726-NL
Clone ID PST21726-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST21726-NL
Sequence
GCATGCCCTGATGGCTCCAGAAGACTCTGTTCTGCACGAGAGCTGAGAGTCTGTTTTGAGGATCCTGAGTGGGAGCAGCT
GATTACCCAACTCTTGGGAAAGGCCACCCAGGTAATAGCTGTGAAGCCCCCACCCATGAACTTGTCCCAGGTTTCTGGTA
ACCAGATTGCTTGGAACACATTTCCTCCTCCTGGGC
Sequence Type genomic DNA
Unitrap ID UNI37394

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72263228..72263420 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040463 (Mybbp1a) NM_016776 MYB binding protein (P160) 1a Gene [Source:MGI (curated);Acc:Mybbp1a-001]

 
Come back to gene ENSMUSG00000040463


For any suggestions or comments, please send an email to unitrap@crg.es