Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST21628-NL
Clone ID PST21628-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST21628-NL
Sequence
CGCATGTGTGAATACTATGGAGTTGATTGTGACAGACAGTCGTGTCTGGCCAGTGTGGATGTATGAGTGTTTGAATGCCT
ATGTGT
Sequence Type genomic DNA
Unitrap ID UNI30172

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34719369..34719453 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028295 (1810030N24Rik) NM_025471 RIKEN cDNA 1810030N24 gene Gene [Source:MGI Symbol;Acc:MGI:1913541]

 
Come back to gene ENSMUSG00000028295


For any suggestions or comments, please send an email to unitrap@crg.es