Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST21512-NL
Clone ID PST21512-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST21512-NL
Sequence
GCGCGCCATGCTTGTTAGCCACACTTCCATACTTTTAAGAGTTGAAATTGGTTGGCTAAATGTTATTTTTATTATACACG
AGTCTGCATGGGATTCTTTTGTAAATTTTAGAACCTCTAGGTTGTGGA
Sequence Type genomic DNA
Unitrap ID UNI29513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 72816161..72816278 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079286 (AL844840.8)  

 
Come back to gene ENSMUSG00000079286


For any suggestions or comments, please send an email to unitrap@crg.es