Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST21509-NL
Clone ID PST21509-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST21509-NL
Sequence
TTCATGGCCATTAGGGGCACACCAGGTTATTAAACACAAGAACTCCCTTCCTTACCCAGATTCACATGGAGGAAGCAGAA
CCAGATTCTTCATGCCTTCATCCTACTTGGTTGGGGGGGTTCATGAACCAAAAAAGGGGGTTGAGAACAACAACAGGCAG
GGGTGTGGGGCCCTGGCCCAGGTCACCTTGCTAGTACAAAGAGCCAGGAAAGGGGAGGGGAGCCTCCGGGAAGGAAAGAC
TACCTCTCTTGAATATTCTTGGAGGGCTATGGTTTTGTTTTCTTGAAAACTGATTTTCCCCTGGACTTCAGGAGTAGTTT
ACAAAATGCTCTAGGGCACACCCACTCAGAAGGCACACAGGGGACAGAGAGGAGGGCTTTTATTTAACCTGACAGCCTAT
GTGCTGAC
Sequence Type genomic DNA
Unitrap ID UNI32004

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84040522..84325964 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020037 (Rfx4) NM_027689 regulatory factor X, 4 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:1918387]

 
Come back to gene ENSMUSG00000020037


For any suggestions or comments, please send an email to unitrap@crg.es