Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST21379-NL
Clone ID PST21379-NL
Vector U3NeoSVFS
Project escells

Sequence tag PST21379-NL
Sequence
GCATGCCTTCAATCTCAGCACTAGGGATGCAGGGTGGGTAGAGCTGTCTATGGTTCAAGGCCAGACACAATAGAGTAACC
ATGTATCAAAAGATGAAGGTGCTGTAATCCCAGCACTCGGGACACAGGTAGATTTCTGAAGCAGAAACTTGTCAATTGGA
TGGTGTTTTGTTGGGACACACATGAAGGAACGTTTAGCTGAAGTGGACACAGGTGAAAGACTAAGGAATGTTTGGCTGAA
GCAGGCATAGATAAAAAGGTGTTTTGTTAAAGCAAGCACATGAAAGGACGTGTGGT
Sequence Type genomic DNA
Unitrap ID UNI12986

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120711328..120711623 296
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048445 (Ccdc57) NM_027745 coiled-coil domain containing 57 Gene [Source:MGI (curated);Acc:Ccdc57-001]

 
Come back to gene ENSMUSG00000048445


For any suggestions or comments, please send an email to unitrap@crg.es