Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST24091-NR
Clone ID PST24091-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST24091-NR
Sequence
CAATTATCATGAGTTTGATGCCGTCTAGGGGTGCAGAATAAGTAAGTACTAGGCTATCCTGAGGCACAAAGGTTAAAAAC
AGTACTGTTTCTAAGAGTACGTGAGCCATGTGAATGCATGC
Sequence Type genomic DNA
Unitrap ID UNI8019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57679723..57679843 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004661 (Arid3b) NM_019689 AT rich interactive domain 3B (BRIGHT-like) Gene [Source:MGI Symbol;Acc:MGI:1930768]

 
Come back to gene ENSMUSG00000004661


For any suggestions or comments, please send an email to unitrap@crg.es