Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST24002-NR
Clone ID PST24002-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST24002-NR
Sequence
GTTTGTTTGTTTTCGGAATACTTGACTAGGCGGAATCCTTGGGCTAGGCAGGTGAATCCGCCCGAGTTAATTCGGGGCCT
CCGTTTTATTCCCTTCAGAAATGCCCGGTGAAGCCACAGAAACCGTCCCTGCTACAGAGCAGGAGTTGCCACAGCCCTCA
GGCTGAGACAGGTAGGTGCCCCGTAGCCTCTTTTGGCTGTTCGGTGAAAATTAATCCTAAAAAACCCCATTTGGGTTGGG
TTAAAGGGGGGACGGGATTACCTTTTTCCTGGCCCTTTTTGGTTAGTTTTTAACTTGAACTTTTAAAAAGAAAAAAATTT
TTGGAAAATGGGGATTTGTAGCCTTTTAGTTAAAGAGATTCTAATTTGTTACCTTGCCTAAGGGGGAAAGGGGGACTCTT
CCGGGGAAAAAAAGTTAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI5812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127473447..127536894 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]

 
Come back to gene ENSMUSG00000061315


For any suggestions or comments, please send an email to unitrap@crg.es