Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST23749-NR
Clone ID PST23749-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST23749-NR
Sequence
CCTAGATCTATCTCTAGGCTAGCCAATGTCTGGTTCCTGGCAATGCCAGGCATGGTCTCCCTCAGGTGTGGGCCTCAAGT
TAGTCCATAAGTCATTAGTTGGCTACTCTCACCAGTTCTGAGCCACTTTTGCCCCAGCATGC
Sequence Type genomic DNA
Unitrap ID UNI304

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44384949..44385089 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]

 
Come back to gene ENSMUSG00000051176


For any suggestions or comments, please send an email to unitrap@crg.es