Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST417887
Clone ID OST417887
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST417887
Sequence
AGGCATGCACCTGCTCATCACAGGCCCCAATGGCTGTGGCAAGAGTTCTCTGTTCCGAATCCTAGGTGGACTCTGGCCCA
CATACAGTGGTGTACTCTATAAGCCCCCACCCCAGCGCATGTTCTATATCCCTCAGTCCTCTCAGTAAAAACCTCTGGAA
AGTAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 70979356..70983873 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031378 (Abcd1) NM_007435 ATP-binding cassette, sub-family D (ALD), member 1 Gene [Source:MGI (curated);Acc:Abcd1-001]

 
Come back to gene ENSMUSG00000031378


For any suggestions or comments, please send an email to unitrap@crg.es