Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST23699-NR
Clone ID PST23699-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST23699-NR
Sequence
GTTACATCTACTTAGAAAGTACTTGTCATTTGAGTTATTTGTTGTTTTTTTCACAAATTAAGGATTTTATACCAAAAGTT
TGGTTAA
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108509695..108509781 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es