Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST23052-NR
Clone ID PST23052-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST23052-NR
Sequence
CTGGTAGCTTGGCCTTACCGGGATTTTAGGGAGAGATGAGAATTTGAACAGGGCGTTTGCCTGCTTGAAGGAGCATGGAT
AAATCCTATTAGTCTGGGTCTTTGCTTGCTTTATTTTCTTCTTACATTTTTTTCTCTCTCCCTTCTTCCTTCCCTCCTTC
CTCTCAGTCTCACTGTGTAGCTCTGACTGGCTTTGGACCCACAGGGTTCCAGACTGTGCCTCGTGAATGCTGTGGTTAAA
GGCAGGACACCACACCTGTAAAGTTCTGTCCCTCTGTCTGGCCGCCATGTCTGTCTTTAAATCTTTTCCCTGCCACCAAG
CCTCTGTAAAACGCATAAAGCCCGCTTCTGTTGCCATCCCCAGAAGCATGAAGCGAAGG
Sequence Type genomic DNA
Unitrap ID UNI6307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123193884..123194256 355
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031818 (Cox4i1) NM_009941 cytochrome c oxidase subunit IV isoform 1 Gene [Source:MGI Symbol;Acc:MGI:88473]

 
Come back to gene ENSMUSG00000031818


For any suggestions or comments, please send an email to unitrap@crg.es