Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST23007-NR
Clone ID PST23007-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST23007-NR
Sequence
GTATTTGTTTCTCTTCCTCTAAAGTTAGTGGCTTTGACCTGGAGTTTATTGGTGTGTTTGTGTATGTGTGTTTTGTGAAA
GTTCCTGTATGGATTTTAGAGGTGTCCTTGTACCTCCTTAAATTGAATGCAAAATGTAATATGAATGTTCCTCATATTTT
TTCAGAGAAGCTAATAGCCTTTGATCAGTGTGCTAAAGTTAGCCATCTTTTGATTCTTTTAATGGTGTATTTTCTTGAAT
CCTACGTCATTAGACTTCAAATTCTAGTATCTGGCTCTTTTGCTAGGTCTCTAGCAAATGCCTTATAATTTGGAAATAAA
TGCTTTCTTAATTCATAGCTGTATTTTTTTCCCCATAGCCTGTTTGGGATTCCTA
Sequence Type genomic DNA
Unitrap ID UNI37413

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5293304..5293668 331
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024853 (Sf3b2) NM_030109 splicing factor 3b, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:2441856]

 
Come back to gene ENSMUSG00000024853


For any suggestions or comments, please send an email to unitrap@crg.es