Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST22709-NR
Clone ID PST22709-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST22709-NR
Sequence
ATACTATTTTTATTATTATTGTGACAAAATGTTAAATGGATATTAAAGAGAATAAATCATGATTTCTCTTCTTTGGGGTT
CAGAGTAACTGAAGATTGTGGGAAGGGGATTTAGGCTTTGGGGAACAGGGACCTGCATGC
Sequence Type genomic DNA
Unitrap ID UNI30001

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69499781..69499920 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es