Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST23767-NR
Clone ID PST23767-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST23767-NR
Sequence
ACTATGTTTACCTGAGACACATTGCATTCTGATTTTTTTAAAAAGGCAACTTCGTTGTAAACTTTCGCAGAGTGCATTAT
ATCTGTATATAAATATAAACGTACAAAGACCCGGGTCTTTGTGTTGAAGAAAAGTAAAGGATAACAAGTTACTCTTGATT
TGATGCTGGGGCCGCAACTCAGAGCCTCATGATGCTAAGCACTCTCCTGCTGAGCTACACCCTAGCCCAAATAGTTAGCT
ATTGTCTGAATGTTGTAGGCCCTGTG
Sequence Type genomic DNA
Unitrap ID UNI6305

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20325113..20325374 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060510 (5730601F06Rik) NP_001128491 RIKEN cDNA 5730601F06 gene Gene [Source:MGI Symbol;Acc:MGI:1924769]

 
Come back to gene ENSMUSG00000060510


For any suggestions or comments, please send an email to unitrap@crg.es