Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST23628-NR
Clone ID PST23628-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST23628-NR
Sequence
GGATTGCCATCTACGAACTCCTTTTTAAGGAGGGCGTGATGGTCGCCAAAAAGGATGTCCA
Sequence Type genomic DNA
Unitrap ID UNI15429

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20822631..20822691 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063427 (CT010490.10)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27771338..27771398 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052146 (Rps10) NM_025963 ribosomal protein S10 Gene [Source:MGI (curated);Acc:Rps10-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95426222..95426282 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060438 (AC092479.16)  

 
Come back to gene ENSMUSG00000060438


For any suggestions or comments, please send an email to unitrap@crg.es