Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST23200-NR
Clone ID PST23200-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST23200-NR
Sequence
CCATATTTGACTAAATTCTTCAAGCGTATGTTAAAAATGTGCTTCCTCCTGCCTTCAGTAGGCCGGCTTTCTCTTCCCTT
CAGCCCTTAGGCATTTAAAAAGCCTTGATGCCTGCTGGGCCTTTAAATATGCTTTCTCCATGGCTGGGGAGCCAAGCTTG
GAGCTTTTAAGGAGTGCGGCAAGTCTTCTCTGACCTACTTCCTTTGGCTGCACTGCATGC
Sequence Type genomic DNA
Unitrap ID UNI15056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25699238..25699456 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es