Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST21778-NR
Clone ID PST21778-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST21778-NR
Sequence
GGAACACTGGAGTTTTAAAAGGAGCTGAAGATACTTTGTTTTTTAGTTGTCTTGGGAGTTAGCTCAGCCTCTCCTTAAGT
GAGCGTTCTTCGCTGTCACCAAGCCATCAGTCCCTACAACTGTAGTTCTGAGCTGAGAGGGACTTCGTCTCATTGCAGTG
ACAACCAGAACAAAACAAAAAGTCCCTTTTGGACGGAAAGTCCCCTGCAGCCCGAGGTGAATGGCTTGGCCTCGGCTCAC
ATGGTGCTTTGCAAAGTGTGCCTGGGCTCATGGGTCCCTGTCGCTTCTGCGGTACCATGCATGGTGACTCCAGGCCAGGT
CTGTAATTGTTTGGTCTGTGTTTGTCTTTGGTCTTTACTAGGTGAAAATCCCCAAT
Sequence Type genomic DNA
Unitrap ID UNI4627

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151703211..151703574 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028936 (Rpl22) NM_009079 ribosomal protein L22 Gene [Source:MGI (curated);Acc:Rpl22-002]

 
Come back to gene ENSMUSG00000028936


For any suggestions or comments, please send an email to unitrap@crg.es