Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST23095-NR
Clone ID PST23095-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST23095-NR
Sequence
ATTGTAGTCTTTCTGTTTTTATGTTTGGGATATGTCTGTATCATGTGTATATTTGGGGTATGCTTGTATCCTATGCATGC
Sequence Type genomic DNA
Unitrap ID UNI14400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74709753..74709831 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024067 (Dpy30) NM_024428 dpy-30 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913560]

 
Come back to gene ENSMUSG00000024067


For any suggestions or comments, please send an email to unitrap@crg.es