Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST22687-NR
Clone ID PST22687-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST22687-NR
Sequence
AAGGAAGTTGTCCCTACAACCCCTTAACCCCTACCCTGTGCCTCACACTGTTCTTTGTCTCTAGTATGCCGTGCCCGTGG
TAAAATACGACCGTAAGGGTTACAAGCCTCGCCCCCGGCAGCTGCTGCTCACGCCCAGTGCTGTGGTCATTGTGGAGGAT
GCTAAAGTCAAGCAGAGAATTGATTATGCCAACCTAACCCGGTTAGCTGGAGCAGAGGCCTGCATGGGTGGGAAGGAGCC
CTGCTCCCAACCATCGCCTCCCTGACCTCTGTTCTCCCCTCCTCAGGAATCTCCTGTCAAGTACCCTGAGTGATAAGCCT
ATTTGTGCTTCACGTGCCAGCGTGAAGACAACCAAGCANAAGGTTACCCCTTTCAGGGCCTGGGAGGCCGGA
Sequence Type genomic DNA
Unitrap ID UNI37427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75485025..75485368 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017774 (Myo1c) NM_001080775 myosin IC Gene [Source:MGI (curated);Acc:Myo1c-002]

 
Come back to gene ENSMUSG00000017774


For any suggestions or comments, please send an email to unitrap@crg.es