Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST21851-NR
Clone ID PST21851-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST21851-NR
Sequence
ACGTTTTGGTGCCTTGTTGGAGATTGAGCCCTATGAATTGTGGCAGAGAAAGTACTGTATCCACTGAGTACATCCATAGC
CTATGGAGATATTAAAGGGAGTACAGTGAATTGTATGTAGGCTATATACAGGTACTAGGCCAAGACTTGCATGC
Sequence Type genomic DNA
Unitrap ID UNI37429

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 135121457..135121609 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030795 (Fus) NM_139149 fusion, derived from t(12;16) malignant liposarcoma (human) Gene [Source:MGI (curated);Acc:Fus-007]

 
Come back to gene ENSMUSG00000030795


For any suggestions or comments, please send an email to unitrap@crg.es