Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST417733
Clone ID OST417733
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST417733
Sequence
GACTGAGTAAGTATGGAATACGAGTCGTCAGTGGCCAAGTTTCCAGTGACTATCAAACAACAGACTGTACCCAAGTTGTA
TGACCCTGGACCTGAGAGGAAGATCAGAAACCTGGTGACCATTGCCNCTNAATACTTNNATCCGNCNGCACTTTGCTTAT
CGAGAGCGTGCTGTCANGAGNTTTGCNTGCATNCNTACNCTNCGACNTCANNTGTNTANCTGTANCNNGAGNGACNGGCT
TAGGAATNCCNNNGGTTAAANANAAGAGATGACATACTGGGGAGGTACNTACACGCATGCCCTTTGGGAAGGGCNTGGTT
TGCTGGGAGGAACCTGGCCATCTCACAGGTGACTACTAAATATGTCCTCTGGGTGGACGATGACTTTCTCTTCAGCGACA
AGACCAAGATTGAGGTACTGGTGGATGTCCTGGAGAAAACCGAACTG
Sequence Type mRNA
Unitrap ID UNI18688

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95729670..95735264 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013418 (B4galnt2) NM_008081 beta-1,4-N-acetyl-galactosaminyl transferase 2 Gene [Source:MGI (curated);Acc:B4galnt2-001]

 
Come back to gene ENSMUSG00000013418


For any suggestions or comments, please send an email to unitrap@crg.es