Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST23127-NR
Clone ID PST23127-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST23127-NR
Sequence
GAGGTATATGTGGCTTTGGTCTCCAAGGATAGTATGCTGGCATCTGTTACTTGATTCAAATAAGAATA
Sequence Type genomic DNA
Unitrap ID UNI37432

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 100394374..100394441 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000568 (Hnrnpd) NM_007516 heterogeneous nuclear ribonucleoprotein D Gene [Source:MGI Symbol;Acc:MGI:101947]

 
Come back to gene ENSMUSG00000000568


For any suggestions or comments, please send an email to unitrap@crg.es