Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST21738-NR
Clone ID PST21738-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST21738-NR
Sequence
TGGGGTGCCACTACAGTTATTTGCTGTCCCAGAGTGAGCTTATCAGCATCCTTGACAAGTAATGCTACTGCAGCAATAGC
TTTCAAGCAAGAAGGCCACCTGCTGGCAACAGGGTCTAACTTCTTGGATAGGTAAGCCACTGGCCTTTTTCAAGGTCCCA
AAGTCTGGGTAGACTCCTATGGCAACCCCTGCTCTCTCAATAAAGAGTGAAAGGCTTGGTTAGGTCAGGCAAGGCCAAGG
CTGGGGCCATCAGTAGGGCTTTTTAAATTTCTTTAAAGGCTTTCTGGTGATCTGGGTTCTACACAAACACCTCCCCTTCC
TTGGCTAGGGGGTACAAGGGGCAGCTAAGGTCGCAAACCCAG
Sequence Type genomic DNA
Unitrap ID UNI3802

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126935247..126935608 362
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034906 (Ncaph) NM_144818 non-SMC condensin I complex, subunit H Gene [Source:MGI (curated);Acc:Ncaph-001]

 
Come back to gene ENSMUSG00000034906


For any suggestions or comments, please send an email to unitrap@crg.es