Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST20596-NR
Clone ID PST20596-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST20596-NR
Sequence
GTCTTCTTCTCTGCTCTTACCCAGCCAGAATGTACAACCCTGTGAGATTCTCCGTACAAAACACTTTGTGCTTTGTTGCC
ACAA
Sequence Type genomic DNA
Unitrap ID UNI30289

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134657217..134657300 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053877 (Srcap) Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]

 
Come back to gene ENSMUSG00000053877


For any suggestions or comments, please send an email to unitrap@crg.es