Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST22623-NR
Clone ID PST22623-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST22623-NR
Sequence
CCGGCTCTTGGGCCAGCGGACTGAGCGGTGGAGCAGAACTTGGGTGCCTCGGGGACCGCCAAAAAGTGGCCTTGTCCACT
TCTCTGAGGCGGAGGACTGAGCCTTCCGCCACGCGCGGGCTGTTCTTTGACTCGTGCATGGTGCTATCGAGGTGACTTAA
TCCCGATTCCTCGAGTCGAGCTCGGAAGGCAAGCAGCCATGTGCAAGCTGCCGATTTGAGTTGATCTCTGCTAATTTTCG
TGTCTGTTTAAGCTCGCTGAATGCCAGCTACTGCGGTACTTACTCTAATTAGGGAAGAAGTTGGCGAAGTCCTGTGTCTG
GGTAGCCACTGAGAGATGCTGGGAAC
Sequence Type genomic DNA
Unitrap ID UNI12979

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 25310262..25310607 346
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025290 (Rps24) NM_011297 ribosomal protein S24 Gene [Source:MGI Symbol;Acc:MGI:98147]

 
Come back to gene ENSMUSG00000025290


For any suggestions or comments, please send an email to unitrap@crg.es