Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST22435-NR
Clone ID PST22435-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST22435-NR
Sequence
CTCCTTTTTCTTCAGCCACAGGCTCCCAGACATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATATC
AAGAGGATGGATTCGACTTAGACTTGACCTGTATCCATTTCTGCGGCTGTTCCTCTTTGCTTTTCTGTCACTCTGATAAC
GTGGGAGTAGACGGATGCGAAAAATTTCTGTAGTTGGGGTGACTATAACGTTTAATTCTGGGCGCATTTCTAGATCGTGC
ATATTGTGTCTCTTCCAGTGTATTCAACCTAGGGAGTGTTCGGCTAGACGGAACTCATGCCTCCTTGCAAGTGTCAAGGC
ACGGATTGTTTTCTTGTC
Sequence Type genomic DNA
Unitrap ID UNI32364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32832904..32833241 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013663 (Pten) NM_008960 phosphatase and tensin homolog Gene [Source:MGI (curated);Acc:Pten-001]

 
Come back to gene ENSMUSG00000013663


For any suggestions or comments, please send an email to unitrap@crg.es