Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST22331-NR
Clone ID PST22331-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST22331-NR
Sequence
GGGTCAGCTTGGGGCCCTAGGTAGAGTGGTTGTCCAGTTTAGCATCAACAGAAATGCTACTTTCATAGCAGCAAATGCTA
TTTTCCTTGATGAGTTATACTGACATTCTCTGTGCACACGTTCCAAACTCTGTCCCCAGTGTATGATAACACCAAATAGT
TGCAGCCTCTTACTCCCTTTTTAGGTTCCCCTCCAGACTCTTTGCACCAGAGGCCCTCCTGAAGAAGATGCTCCATCCTC
GCTTCCCGTTTCCCCATATGAGAGCGAGCCTTGGAAGTACCTGGATTCAGAAGGTGCCTGAGGCTAGGGGAAAGGAGGGG
AAGATGCAGCCCCGAAGTGACTACAGAAGACCCCCTTCCACTCTCGCCATGCCCG
Sequence Type genomic DNA
Unitrap ID UNI22504

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36051565..36051927 332
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024436 (Mrps18b) NM_025878 mitochondrial ribosomal protein S18B Gene [Source:MGI Symbol;Acc:MGI:1914223]

 
Come back to gene ENSMUSG00000024436


For any suggestions or comments, please send an email to unitrap@crg.es