Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST21269-NR
Clone ID PST21269-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST21269-NR
Sequence
ATTCAAAGCAAAAATGGGAAAGGAAAAGACTCACATCAACATCGTCGTAATCGGACACGTAGATTCCGGCAAGTCCACCA
CAACCGGCCACCTGATCTACAAATGTGGTGGAATCGACAAGCGAACCATCGAAAAGTTTGAGAAGGAGGCTGCTGAGGCA
AGTATAAGGCAAAAGGAGGGATGGGAATTCTTTAAGCAGGGAGTAGAACCTAGGTCTTGGGTGTACTAATTAGAAGTCAC
TTTGCAGATGGGAAAGGGCTCCTTCAAGTACGCCTGGGTCTTAGACAAACTGAAAGCTGAGCGTGAGCGTGGTATCACTA
TTGACATCTCCCTGTGGAAATTCGAGACCCAGCAAATACT
Sequence Type genomic DNA
Unitrap ID UNI12389

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78328116..78328474 356
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037742 (Eef1a1) NM_010106 eukaryotic translation elongation factor 1 alpha 1 Gene [Source:MGI (curated);Acc:Eef1a1-001]

 
Come back to gene ENSMUSG00000037742


For any suggestions or comments, please send an email to unitrap@crg.es