Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST22487-NR
Clone ID PST22487-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST22487-NR
Sequence
ATGTCACATTTTCACCAGCCACTATTGAAGAAAGAACTTATAAAGTTTTGCCGTGAAGCAAGGAGGCAAAAGAGAATCGG
TTGGTAAGTAGCTGGTGACCCACCCAGCCTAGTCCCTGGCTCTTGGGCACTGTCCACTTTGTGATGGGACTTGTATATAT
ACTAATGTGAGGTTTAAGTGTTTTTCATCCTCTATTTATTAAACATTGCTATAAGCTGAATATTGGTAAGACCAGGAGAG
AAAATGACAG
Sequence Type genomic DNA
Unitrap ID UNI24975

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106793237..106793481 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032575 (Armet) NM_029103 arginine-rich, mutated in early stage tumors Gene [Source:MGI Symbol;Acc:MGI:1922090]

 
Come back to gene ENSMUSG00000032575


For any suggestions or comments, please send an email to unitrap@crg.es