Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST22409-NR
Clone ID PST22409-NR
Vector U3NeoSVFS
Project escells

Sequence tag PST22409-NR
Sequence
GTAGAAACAAGCCTGAAGCAGACTGTAAAGACCAGCACCTTTGGAAAAGCAGGAATCAAAACCAAGAATTTTATTCAGAA
AAACAGTATGGACAAAAAGAATGGGAAGTCTTATGAAAACAAATCTGGAGAGACCCAGGCTGTAGATAAGACCGATACCA
TAGCAATTCCAAATGGTGTTATAACAAGTAGTTCAGGCTATATTACTAATGGTTATATGAGCAAAGGAGCAGATAATGAT
GGTAGTGGATCTGAGAGTGGATATACCACTCCTAAAAAAAGGAAAGCTAGGCGCAATAGTGCCAAGGGTTGTGAAAACCT
TAATTTAGTGCAGGACAAAATAAATGCAAGAGACTAGTGTCCCAGCATTAAAACAG
Sequence Type genomic DNA
Unitrap ID UNI5210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77505157..77505531 372
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037857 (Nufip2) NM_001024205 nuclear fragile X mental retardation protein interacting protein 2 Gene [Source:MGI (curated);Acc:Nufip2-001]

 
Come back to gene ENSMUSG00000037857


For any suggestions or comments, please send an email to unitrap@crg.es